» »

Bela, zelena in modra soba

Bela, zelena in modra soba

strani: 1 2 3 4 ... 86

billy ::

Ce se cas premakne za en dan nazaj. Se bo vcerajsni dan se enkrat ponovil na popolnoma enak nacin? Imamo ljudje sploh kaj vpliva na to kar delamo? Ce je vesolje samo program, potem je ze vse vnaprej doloceno. Tudi tale thread.

Zakaj bi bilo temu tako? V nasih mozganih so samo zapisane reakcije na dolocene vzroke. Ampak, ker smo Mi program, ki se vedno in v vsakem trenutku spreminja, se reakcije vedno spreminjajo. Nic ni nase zivljenje vnaprej sprogramirano.

Da se malo dodatknem tega nasega algoritma. Vse v naravi je v bistvu en posledicen stave. IF (vzrok) {posledica1; posledica2; etc}.
Ce se premakne en atom snega na pobocju, se bo drug, tretji, nastala bo verizna reakcija, pri kateri je posledica plaz. Ce ta plaz nabere zadostno energijo podere hiso na dnu doline, etc. Vse se samo dogaja na posledici vzrokov. Torej nemorejo biti nasi mozgani nic drugacni. Ampak v nasih glavah se posledice vedno spreminjajo, na novo programirajo, glede na nase obcutke, reakcije iz izkusnje iz prejsnjih vzrokov. Torej _ne_ moremo biti sprogramirani.

ciki57 ::

Se strinjam vsako trenutno stanje v vesolju, je posledica prejšnjega, upoštevajoč neke osnovne naravne zakone.
Torej če se vrnemo en dan nazaj bodo vzroki za naslednja stanja enaki ko včeraj, ane? Torej se bo dan odvil na popolnoma enak način. Vklučno z vsem dogajanjem v naših možganih.

Razen če ni naša zavest še nekaj več kot samo skupek atomov.

A.J. ::

Če je zavest skupna (ena?) potem si jo delimo z alieni, oziroma jo oni delijo z nami?

Thomas ::

V tale program ki je mi, se nonstop vmešava quantum random. Če je kaj na kvantni gravitaciji (in/ali pa Wolframu), potem je pa tudi ta random zgolj psevdorandom. Tako kot v programih naših digitalnih računalnikov.

Jest že mislim (nisem reku vem), da je temu tako. Da se pač odvija le nek determinističen program.

Lahko namreč tudi, da ima ta vgrajen še "čisti" random. Lahko.

V vsakem primeru, pa smo mi (trans)Turingove mašine. Pravzaprav software, ki teče na njih - no.

Nisem hardware - sem software. Žival iz rodu človečnjakov, je samo moj substrat.

Mistificiranje zavesti, da bi bila ta nekaj ne/nad naravnega - je pa le izguba dragocenega computinga!

Man muss immer generalisieren - Carl Jacobi

Thomas ::

A. J.

    Če je zavest skupna (ena?) potem si jo delimo z alieni, oziroma jo oni delijo z nami?

Če se je (zavest) razvila še kje v Vesolju - potem (žal?) ne vidim druge možnosti.

Man muss immer generalisieren - Carl Jacobi

A.J. ::

Če se je zavest razvila še drugje v vesolju in če bi se mi "naučili" zaznavati zavest drugih bi bila to možnost za odkritje marsičesa zanimivega, mogoče celo medsebojnega sodelovanja vseh bitij usmerjenih v nek cilj.

Marjan ::

Glede napovedljivosti.

Ja. To jest že skoz govorim (glej debato o vremenu)

Kljub temu, da je fizika osnovnih delcev podana v verjetnostih, ali pa je celo nedoločljiva. Fizika v velikostnem redu molekule in naprej pa je izračunljiva in napovedljiva popolnoma.

.:joco:. ::

Ja, poleg njih pa še mioni, pozitroni, prosti elektroni, fotoni, mezoni in bogve kaj še.

Ampak biokemični procesi so v človeškem telesu dokaj dobro razloženi. (wish me luck tomorrow at 9AM :D )

Zelo je zanimivo, DNA je napisana enodimenzionalno. Sicer ima 3d strukturo dvojne vijačnice, ampak podatki na njej bi se dali brati v eni dimenziji. In sicer z bazami ATCG. En gen zapisuje eno beljakovino ki nastane v telesu. Beljakovina je sestavljena iz aminokislin, ki so v različnih zaporedjih. Na DNA bo zaporedje ACT pomenilo aminokislino Glicin, GCT bo pomenilo aminokislino Alanin. Tko bi v DNA, ki ima zaporedje ACTGCTACTGCTACTACTACT dobili neko majceno beljakovinico z takim aminokislinskim zaporedjem: GLY, ALA, GLY, ALA, ALA, ALA. Torej le štiri različne baze določajo aminokislinsko zaporedje 21 aminokislin v proteinu. 21 aminokislin se lahko poveže na milijardo in en način, le v različnih zaporedjih. Proteini imajo encimske, hormonske, motorne, prenašalne, obrambne, pigmentne, svašta funkcije. Pomembni so za dihanje. Vse je začinjeno še z različnimi lipidnimi membranami, krebsovimi cikli, oksidativnimi fosforilizacijami, hormoni, steroli,... Kr neki nakladam, ampak uglavnem, preden bi človek/računalnik določil kako in zakaj in kje se bo nekdo nekako obnašal, bodo moji vnuki že gnili pod zemljo...
Pustimo to, gremo k zavesti.

Znano je, da so najosnovnejše človeške funkcije spravljene v podaljšani hrbtenjači in malih možganih. Tako kot dihanje, bitje srca, peristaltika, ravnotežje...

Take podobne živčne tvorbe poznamo že pri mehkužcih (polž, školjka, hobotnica). Znano je, da so že na hobotnicah delali neke poskuse. So postavili dva lonca, rdeče in ne vem kakšne barve in so pod enega skrili hrano. Po nekaj ne vem koliko poizkusih se je hobotnica naučila da je hrana vedno pod rdečim loncem.

Znano je, da so se možgani vretenčarjev razvijali iz majcenega živčnega vozla, ki je služil dekodiranju snovi. Torej vonja. Torej veliki možgani, ki jih imamo, so postprodukt centra za vonj. Seveda so se skozi evolucijo razvijali in nekatera mesta možganov so zasedle funkcije vida, okusa, tipa, sluha, spomina. Kamlu pa je evolucija pogruntala, da rabi tudi nekaj več. To so čustva in zavedanje samega sebe. Ta del je spravljen v sprednjem delu možganov. Pri nekaterih težkih bolnikih (shizofrenikih,...) je pri CT-ju možno opaziti slabša aktivnost sprednjega dela možgan. (Ravno tako pri ljudeh ki kronično pohajo:P ). Znano je tudi, da pri ljudeh, ki imajo tumor v sprednjem delu možganov, slabša razpoloženost, nezavedanje samega sebe, exsistence, bita. Tisti, ki so prestali operacijo, se jim je vzpostavitev teh "čutov" povrnila v nekaj letih. Ker so možgani zelo podobni kot disk. Če nekje ni več prostora, se to shrani nekam drugam. Možgani so zelo fleksibilni. Pravijo celo, da bi bilo presajanje njih zelo enostavno. Če so človeku odrezali del za vonj, si ga je ta razvil nazaj že v nekaj mesecih. Pač, "koda" za vonj se je namestila nekam drugam.

No skratka, malo sem se moral razpisati, zaključek naredite sami, jutri mam izpit...
"Is science true?"
You don't get it.
Science is the process of trying to find out what's true.

Thomas ::


    Če se je zavest razvila še drugje v vesolju in če bi se mi "naučili" zaznavati zavest drugih

Mislim, da so možnosti za direktno zaznavanje zavesti zelo skromne. Kot bi tvoji Windowsi zaznali moje. Če se nekje izvaja nek computing, ga drugi (computingi) ne morejo zaznati drugače, kot po kakšnem fizikalnem kanalu.

pa vseeno:

    mogoče celo medsebojnega sodelovanja vseh bitij usmerjenih v nek cilj.

No, to se pa imenuje (neo)Tiplerizem. ("Naravna") težnja vseh civilizacij v Vesolju, da ustvarijo Omega Point stanje.

To je en tak PROTOKOL.


    Kljub temu, da je fizika osnovnih delcev podana v verjetnostih, ali pa je celo nedoločljiva. Fizika v velikostnem redu molekule in naprej pa je izračunljiva in napovedljiva popolnoma.

Jasno. Vprašanje pa je, če ni nekje spodaj vseeno le Turingovo procesiranje. Če Bohmova deterministična interpretacija kvantne mehanike le ni pravilna.

Ali pa če je Vesolje res mogoče opisati z Wolframovim pravilom 110.

Man muss immer generalisieren - Carl Jacobi

billy ::

Hm..a to malce nakazuje, da imamo vsi ljudje enako zavest?? Ampak sedaj bo problem locit zavest od ostalih programov in misli...naj proba vsak pri sebi poganjam samo program "zavest" v glavi...ce mu uspe. :D


Thomas, samo nekaj me zanima: zakaj ti misliš, da imamo vsi eno skupno zavest? Od kod ta čudna ideja, me zanima.
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::


Če si pazljivo bral, si lahko ugotovil, da nisem mislil niti povedat. Fantje so kar sami prišli do tega zaključka. Namreč se ponuja kot na dlani, potem ko greš v takele premisleke.

Iščem pa že preko 20 let en dober protiargument, da bi ne bilo tako. Da bi le imeli multitudo različnih zavesti. Takoj bi ga sprejel. Zadostovalo bi že, da mi kdo pove, kaj je specifično za posamezno zavest.

  • DNA? - dvojčki imajo lahko isto; možgani nimajo readerja zanjo.

  • spomini? - moji spomini zdaj so 90% različni od tistih izpred 30 let

  • atomi? - skozi se menjajo - celo izmenjujejo

  • kaj drugega? - le kaj?

Tako ostane le še ena druga možnost, ta da je duša res - "nadnaravna". Če ne bi bila tako odvisna od telesa in njegovih hormonov, sinaps in celo alkohola - bi še verjel.

Tako pa ... nam ostane, ko smo zmetali proč vse nemogoče, le še ta divja trditev, ki pa mora biti pravilna.

Razum lahko to še nekako sprejme - emocije pa skoraj nikakor.

Ljudje smo kot otoki - ko morje odteče vidiš, da ni noben stal sam zase.

Man muss immer generalisieren - Carl Jacobi

billy ::

Thomas, kaj takega pa bi clovek res tezko pricakoval od tebe :)

Jaz kvecjemu dopuscam moznost, da imamo vsi enake zavesti. Torej, tako kot imamo enake programe za dihanje, bitje srca, etc. imamo enake programe za zavest.
1) Zavest naj nebi bila takoj prisotna v nasih mozganih, potem bi morala biti tudi v mozganih kaksne opice. Torej rabi dolocen cas, da se razvije. Zaradi cesar, je plod nasih misli in spominov. Torej je edinstvena.
2) Ce nam je zavest prirojena takoj ob rojstvu je tudi enaka vsem ostalim zavestim. Ker bi bila "genska".

Ena od teh dveh moznosti je resnicna :)

Thomas ::


    Thomas, kaj takega pa bi clovek res tezko pricakoval od tebe

Hočeš rečt - tako mistiko? Mi je prav žal, ampak jest poznam samo en kriterij - logiko. Vsi ostali kriteriji izbire trditev, hipotez in teorij so manj pomembni.

Če komu še zgledam gladek po tistem kar izustim - pa sploh ni velik faktor. Bi rekel, da čisto rahlo deluje celo v nasprotno smer.

    Jaz kvecjemu dopuscam moznost, da imamo vsi enake zavesti.

    ... kot imamo enake programe za dihanje, bitje srca, etc. imamo enake programe za zavest.

What did I say?

Queest-ce que j'ai dit?

¿Qué dije?

Was sagte ich?

Kaj sem pa rekel?

    1) ... Zaradi cesar, je plod nasih misli in spominov. Torej je edinstvena.

Tale "Torej" se mi zdi pa meglen. Redko kdaj kdo misli kaj, kar še nihče pred njim ni mislil. Nekateri zagotovo celo življenje ne. "Torej" njihova zavest je klon?

    2) Ce nam je zavest prirojena takoj ob rojstvu je tudi enaka vsem ostalim zavestim. Ker bi bila "genska".

Neka zmožnost samoreflektiranja in rekurzivnega razmišljanja nam je prirojena - zgleda. Potem se na tem verjetno zrenderira zavest. Ki pa zagotovo nima toliko identifikacijske prtljage s sabo, kot bi bilo potrebno za resničnost common sense čveka o enkratnosti in neponovljivosti"

Hehehe - če bil bil včeraj "enkraten in neponovljiv" bi bil danes mrtev - mar ne?

    Ena od teh dveh moznosti je resnicna :)


Man muss immer generalisieren - Carl Jacobi

billy ::

Tale "Torej" se mi zdi pa meglen. Redko kdaj kdo misli kaj, kar še nihče pred njim ni mislil. Nekateri zagotovo celo življenje ne. "Torej" njihova zavest je klon?

Ce je zavest posledica vse ostalih podprogramov, oz se obnasa kot posledica teh podprogramov, je edinstvena. Kajti noben osebek na svetu nima istih misli, spominov, custev kot jaz. Dokaz tega so ravno tisti dvojcki. Veliko stvari imajo identicnih, ampak vseeno ima vsak svojo zavest.

Thomas ::


    se obnasa kot posledica teh podprogramov, je edinstvena. Kajti noben osebek na svetu nima istih misli, spominov, custev kot jaz

Če bi pa ti imel drugačne misli, bi bil pa (takoj?) nekdo drug?

A misliš, da zavest kontrolira tvoje misli, potem pa če pomisliš na kaj drugega, pa zavest reče - opa, tale je pa zdej en drug, naj enga druzga žuli čevelj naprej?

Karkoli že misliš in se "duhovno izpopolnjuješ" - ne preswitcha te zlahka.

A misliš, da zavest kontrolira checksum ali celotno vsebino misli in čustev?

Checksum se lahko ponovi, celotna vsebina je pa živ hudič za prevert. Bi 99% časa lahko delal izključno to.

Pa če pride do 35% enako - pri 36% se pa zalomi - potem pa nisi več ti?

Kako naj bi to bilo - vas prašam!

Man muss immer generalisieren - Carl Jacobi

.:joco:. ::

Thomas, se povsem strinjam. Če človeku odrežeš nogo je to še vedno on. Če mu presadiš srce, je še vedno on. Če mu pa presadiš samo tisti majcen delček možganov, v katerem ima "vprogramiran" bit (zavedanje samega sebe), potem pa to ni več on al kaj?
"Is science true?"
You don't get it.
Science is the process of trying to find out what's true.

billy ::

Ne ne ne :)

Zavest je posledica vsega tega. Sploh ne nadzira nic, kvecjemu je nadzirana :)

Bi si pa upal trditi, da se zavest vedno spreminja. Ampak, veliki delez zavesti ostane enak. Torej 99.999999% je istih, tist 0.000001% se pa spremeni. Kar iz mene ne naredi drugega cloveka.

"wow, kako si se pa ti spremenil, cist drug clovek si", to verjetno dostikrat slisimo, se posebaj, ce se srecamo z nekom, ki ga nismo videli ze kar nekaj casa. Za njega je tistih 0,000001% postalo 10% in se mu zdimo cist drug clovek.

Nisem pa rekel, da smo drug clovek. Naso zavest smo samo nadgrajevali in spreminjali.

billy ::

Da dodam malce ZF:

mogoce se pa v vsakem trenutko, oz v vsakem impulzu "ure univerzuma" nasa zavest teleportira v eno drugo, vmes se pa kak parameter spremeni :)


Thomas, to idejo 'skakanja zavesti' si začel ti v enem topicu o teleportiranju. Je pa zanimivo, da ti, ki trdiš, da ne obstaja nikakršna 'sila x' v tem našem vesolju, sedaj trdiš ravno nasprotno - da obstaja neka vseobsegajoča zavest, ki je del vseh in je v vsakomur...
Pa še vprašanje: kaj pa živali? Primati naprimer so nam zelo podobni. Z gorilami se da celo sporazumevat prek znakov, ki jih uporabljajo gluhonemi. Skače torej ta 'zavest' tudi po glavah živali, ali je samo nam lastna? Inče je samo nam lastna, zakaj?
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::


To da "skače", je samo nekakšna bergla za pomoč pri razumevanju. Podobno kot virtualna sila v statiki.

Ni niti skakanja, niti te virtualne sile - ampak je pa oboje dober pripomoček za razumevanje.

Skače pa toliko, kot skačejo Windowsi iz mojega PCa v tvojega. Na obeh so. (Ako nisi ti kakšen LINUX fan, seve).

Pa še to je, da v resnici zavest ni stalno aktivna. Zaspi - najmanj.

Nobene x-sile ni tukaj. Niti kje drugje.

Man muss immer generalisieren - Carl Jacobi


Thomas: torej so na mojem računalniku ISTA okna, kot na tvojem?
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::


A so na tvojem PCu ISTA wokna, kot so bila pol ure nazaj?

To je ISTI program.

Če bi se zavedala - kar načelno ni nemogoče - bi videla moje in tvoje fajle. Kakšne celo ISTE.

Man muss immer generalisieren - Carl Jacobi

DoloresJane ::

No, kje pa je potem meja, da je oseba identična?

Fer vprašanje. Ampak odgovor lahko dobiš na piru. (Jest častim)

Jaz bi tudi izvedela. Kje je meja? Mislim, da ravno v zavesti, vendar potem nastopi problem (shizofrenija). Hm?

Odin ::

Če je to (preskakovanje duše) resnično, potem bi bilo dovolj, da gre v protokol samo en človek, druge se pa lahko ubije. Tudi ne bi bilo potrebno oživljanje naših prednikov. Če imamo vsi eno zavest, je to edino logično.

Jaz seveda nisem pristaš te ideje!!!

Double_J ::

Kot vidim Thomas pravi, da je za to, da sta osebi identični, potrebno preslikati zgolj določen procent vseh atomov.
50% verjetno ni dovolj. Dodamo še 40% atomov na ista mesta, morda se še vedno nič ne zgodi.
Nato dodajamo atome enega in po enega.
Kar naenkrat ko vstavimo nek atom na pravo mesto se zavest zalaufa.
Torej je vbistvu odločilen en atom?

Sicer je pa zadeva kakor koli gledaš izjemno sumljiva ter težko predstavljiva.
Po eni strani moraš naredit kopijo osebe, po drugi je pa niti ni treba, če hočeš razdeliti zavest, ker pozicije atomov ni nujno, da morajo biti determinirane.

Otrok, ki je star 5let ima zelo podono razporejene možgane kot njegov enojajčni dvojček. Pa sta različna.
Ta isti človek pri 80letih je popolnoma drugačen od prejšnega samega sebe, pa je še vedno isti.
Ravno zato, ker se zavest vklesa, ter jo pozicije atomov ne motijo.
Samo, ko se zavest vzpostavlja je pa kritično odvisna zgolj od pozicije atomov.
Ravno to razjasni, da imata enojajčna dvojčka različno zavest. Ena majhna razlika, ter vzpostavi se različna zavest.
Ko pa je zavest vzpostavljena se nosilec lahko neomejeno spreminja, zavest ostaja enaka.
Enostavno mora biti tako. Vse drugo je absurd.

Btw, ste se že vprašali zakaj ste ravno to, kar ste?
Kaj je bilo tako posebnega v zarodku, da sem to ravno jaz?
Ta svet je zelo skrivnosten, to je treba priznat, pa čeprav so morda temelji povsem banalni.
Iz te preprostosti nastajajo izjemno kompleksne stvari.

Zgodovina sprememb…

  • spremenil: Double_J ()

billy ::

Double_J pa vsi ostali: Kaj je sploh zavest za vas?

Odin ::

Zavest Je po moje zavedanje samega sebe. To ni povezano s spominom.

Čeprav se sliši smešno, sem se že prej dostikrat spraševal zakaj sem ravno v sebi, v čem se moja zavest loči od ostalih. Thomasova teorija se mi zdi zelo zanimiva, vendar vseeno preveč tuja.

Mislim, torej sem.
Rene Descartes

Kdor razume ta stavek ima zagotovo zavest:D

billy ::

Tocno. In iz tega stavka lahko sklepamo, da je zavest samo posledica nasega misljenja. Torej zavest _ne_ obstaja, obstaja samo misljenje. In _to_ je zavedanje samega sebe.



Zato imata dvojska, ki si delita mozgane, razlicni "zavesti", ker imata vsak svoje misli in misljenja.

Zdaj razumete? Super :)

billy ::

Čeprav se sliši smešno, sem se že prej dostikrat spraševal zakaj sem ravno v sebi, v čem se moja zavest loči od ostalih. Thomasova teorija se mi zdi zelo zanimiva, vendar vseeno preveč tuja.

Zakaj si v "sebi" ? Zato, ker si posledica svojega misljenja. Kaj sploh misli so? Nic drugega kot posledica reprogramiranja nasih mozganov.

Odin ::

Hm. Delno ti dam tudi prav, vendar sem skeptičen.

Recimo, da bi tehnologija v letu 2015 že tako napredovala, da ti lahko spremenijo spomin(že od rojstva). Bi bil ta človek še isti, ali bi bil to nekdo drug? Glede na to, da se dogaja v istih možganih.

billy ::

Hja, malce ZF odgovor. Kot sem ze v enem prejsnjih odogovor napisal, se nasa zavest vedno spreminja. Vsakokrat, ko preskoci nov impulz v nase nevrone, se spmrenimo. Nismo vec isti kot prej. Vedno se razvijamo (evolucija? :) ). Tudi ti vec nisi taksen, kot si bil pred 5 minutami.

Bilo bi zelo zanimivo videt, kaj bi se zgodilo, ce bi ti v spomin dali nekar, kar nebi moglo biti res. Kako bi se takrat obnasal?

Mogoce je v tem finta tranvestitov. V njihovem spominu je nekaj narobe in pod parameter Spol imajo vpisano Zenski. Njihovi cuti in okolica pa jim daje vedet, da so moski. Kaj bi se z njimi zgodilo, ce bi jim umetno vstavili spomin, da so moski? Ne vem. Se bom pustil presenetiti :\

Bajo1 ::

Bi reku, da mamo kr taprav random. Če ne, si lahko zamislimo naslednji scenarij:
Hipotetično nam rata nam nardit dovolj computing powerja, da lahko zračunamo vse pozicije vseh delcev vesolja in predvidimo na ta način, kako se bodo gibali v bodoče (napovemo prihodnost). Se bo odvila na tak način, kakršnega bo mašina izpljunila? Eeee? TILT! Glede zavesti. Osebnost je sigurno odvisna od spominov, ki jih resda ne priklicujemo vsakodnevno na plano, ampak so v bistvu v nezavednem področju, in imajo še kako veliko vlogo pri našem dojemanju sveta. Tako da če preneseš spomine nekoga drugega na nek drug wetware, dobiš neko drugo osebnost, zavest se pa seveda ohrani. V tem primeru najbrž postaneš nezavedno nekdo drug. Čeprav jst ne bi trdil, da je zavest popolnoma neodvisna od spominov, ker konec koncev za samo vzpostavitev zavesti rabimo precej inputa. Bojda se nekateri reveži z ekstremno nizkim IQ sebe celo ne zavedajo, kako je pa z zanemarjanimi/nesocializiranimi otroci, s katerimi se starši niso popolnoma nič ukvarjali ter jih zaklepali v klet, pa ne vem, ampak najbrž podobno. Ampak mene zanima, kaj recimo doživlja oseba, ki smo jo skopirali v dve sosednji sobi? Rekel si, da je subjektivni filing tak, kot da bi se nonstop teleportiral. Se pravi, da se zavest seli po enem x kanalu, katerega obstoj si nato zanikal? Ker drugače imamo 3 enake osebe a vendarle vsako s svojo zavestjo. Ni mi pa jasno, kaj misliš s tem, da se lahko intervali tudi prekrivajo. Da se lahko zavedaš, da si hkrati na dveh mestih? Ker v tem primeru bi dobil eno čist novo definicijo zavesti, ker bi bil ta človek edini, ki bi bil česa takega sposoben. Tako pa je zavest pač stranski produkt procesiranja možgan- če bi meni spremenili vse spomine, bi pač postal nekdo drug, ampak ker bi stvar laufala na mojem wetwaru, bi blo vse ok. Če pa mene skopirajo na 10 komadov, bo pa vsak meni identičen, ampak zavedal se bom samo samega sebe. Ker se zavest ne more selit na en drug wetware, ampak se lahko tam kvečjemu vzpostavi nova zavest.

Tloramus ::

Mislim, da te tri osebe od prvega trenutka naprej (od tenutka, ko drugima dvema dodajo zadnji mankajoči delec in pustijo dogodkom prosto pot) lahko popolnoma različne, lahko pa tudi popolnoma enake osebe, saj je dogajanje v kvantnem svetu več ali manj random.

Kombinacij je neskončno:
lahko se zgodi, da prvi klon oslepi;
lahko vidijo vsak barvo svoje sobe;
lahko vidijo vsi belo;

Please, komentirajte.

Zgodovina sprememb…

  • spremenil: Tloramus ()

Tloramus ::

post scriptum: nisem bral vseh postov, tako, da...
Expirience is what you get, if you don't get what you want!

Thomas ::

Če imam prav, potem ima to svoje zelo slabe in zelo dobre posledice.

(Zelo?) slabe:

  • povsem sam si - kakor vsi solipsisti tako ali tako

  • samo monlog je. Na vseh nivojih medčloveškega občevanja

  • kjer koga ta trenutek devljejo v muke - devljejo tebe. Po celem Vesolju

Zelo dobre:

  • noben sentient ne bo ostal zadaj, pozabljen in zapuščen

  • medgalalktičnih, intercivilizacijskih vojn ne bo. Razen morda z nesentientskimi formami: supernove, bakterije, virusi, lakota, mraz ... Kar pa je glavna fronta od vedno, zadnja bitka pa že znosno blizu, če le ni de Garisovih artilectov.

  • foušija je popolnoma odveč. Nobene fešte nisi zamudil - in nobene ne boš.

Samo je od posledic prav žal popolnoma neodvisen. Prav je odvisen le od skrajno hladne logike.

Man muss immer generalisieren - Carl Jacobi


Thomas: ne vem glede zadnje 'prednosti', glede fovšije...jaz nič ne vem o tem, da bi bil na fešti z komerkoli že - kaj mi torej pomaga misel, da 'sej moja zavest je pa bla tam'?
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::


Predstavljaj si, da boš doživljal nekaj lepega naslednjih nekaj dni. Potem pa veš, da boš doživel amnezijo.

Ti to potem vseeno še kaj pomeni - čeprav bo kasneje pozabljeno?

Ko si star 90 let in si pozabil neke lepe reči - so bile zato kaj manj lepe - kaj manj resnične?

Zdaj že, se ne spomniš kakšne lepe reči iz otroštva - pa vseeno prav, da je bila - mar ne?

Man muss immer generalisieren - Carl Jacobi


Ko enkrat nekaj res popolnoma pozabiš - niti ne veš, da se je to zgodilo in si torej do tega popolnoma ravnodušen. No ja, tak je moj POW. Ampak še zmeraj sem mnenja, da ima vsak svojo zavest.
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Odin ::

Moram priznat, da me to o zavesti vedno bolj muči:\

Ime mi je Janez. Hotel sem se teleportirat v drugo boljše, močnejše, lepše telo. Ta poizkus je spodletel. Nato pride neka oseba, ki trdi, da je jaz. Verjetno je ta oseba preveč pila.

Ime mi je Janez. Teleportiral sem se v drugo telo, vendar so original pustili živeti. Ne morem verjet. Gledam sebe!! Ampak kako je to mogoče, če pa sem jaz tukaj!!! To mu grem tudi povedat, vendar misli, da sem nor. Če sem pošten, bi jaz mislil enako.

Takšen prizor, ki naj bi bil v prihodnosti mogoč, mi ne gre v glavo. Spomini zgleda igrajo veliko vlogo.
Danes so znani primeri, ko oseba zgubi (nesreča, bolezen) spomin. Uči se vsega znova in se življenja pred nesrečo niti najmanj ne spomni. Vseeno pa ima ta človek še vedno isto "zavest".
Zdi se mi, da ima Billy prav. Zavest je le produkt našega programa(možgani), ki je pač "malo" bolj kompleksnejši kot kakšen računalniški program;(

Thomas ::


Pa vendar si boš nekaj lepega privoščil - čeprav veš že zdaj, da boš nekoč pozabil.

Zid pozabe ali zid nevedenja nas ne odvrne. Dovolj je, če veš nekje in za trenutek - pa se je tisto zgodilo. Celo "zapisalo v prostorčas".

Kar se pa tiče tega, da misliš, da ima vsak svojo zavest - pa samo upam, da imaš ti prav in jest narobe. Je pa čedalje manjše to upanje.


Man muss immer generalisieren - Carl Jacobi


No ja Thomas, v tvojem zadnjem stavku se pač ne strinjava:).
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::


Ja no, saj nič hudega.

A maš pa kakšno povsem specifično lastnost za vsak primer zavesti? Takšno lastnost ki se ne ponovi in unikatno definira tisto zavest?

Man muss immer generalisieren - Carl Jacobi


Hm, spomini? Dve osebi ne moreta imet enakih spominov, tudi če bi ju atomsko klonirali - razlike bi se pokazale v milisekundi po zaključku prenosa.
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::

Ne, če bi padli v dovolj enako okolje. Potem se ne bi kar dolgo.

Bilo pa jih je tudi že mnogo s totalno amnezijo. Niso bili vsi nezavestni.

Se pravi - tole ni dobro. Spomini itak ne določajo zavesti. Zavest jih samo "gleda" - kakršni že so. Kakorkoli se že razvijajo naprej.

Man muss immer generalisieren - Carl Jacobi


Dve osebi ne moreta imet popolnoma enakih spominov - teško bi naredil za dve osebi dve popolnoma enaki okolji, kjer bi bilo vse isto. Teško, če že ne nemogoče. Osebi v različnih sobah - dovolj bi bila npr. ena molekula v eni sobi, ki bi osebi šla v nos in jo prisilila, da kihne - pa imaš razliko.
In naši spomini nas definirajo, dogodki, ki ustvarijo spomine, določijo, kako se bomo obnašali in kako se bomo odzvali v določenih situacijah. Tako da zame so spomini del osebe.
Okoli tistih z totalno amnezijo - lahko, da so se zavedali - a funkcionirali niso več. Imeli so osnovne funkcije, ki ti jih narava 'vžge' v sistem - drugega nič. Sej tega se vsega naučiš skozi dogodke v življenju - hoja, komuniciranje, itd.
Uf! Uf! Je rekel Vinetou in se skril za skalo, ki jo je prav v ta namen nosil s seboj.

Thomas ::

Prav, pa naj bo po tvojem. Potem pa moraš imeti mehanizem, ki vso dato, kar jo imaš, nekako čekira. Ta mehanizem mora takoj vedeti, da ta slika pa ne spada več v nekaj-deset-letni film?

Samo en kih - pa si že čisto druga zavest?

Po drugi strani pa - včeraj si kihnil, danes pa ne - pa še vedno ista zavest?

Kakor hitro priznamo temporalno (časovno) identičnost zavesti med danes in včeraj - zelo težko zagovarjamo spatialno (prostorsko) različnost zavesti.

Moral bi biti kar en dober mehanizem, ki bi to zagotovljal. Žal ga ne vidim.


Man muss immer generalisieren - Carl Jacobi

Odin ::

Spominov zaenkrat ni imela nobena oseba istih, kot druga. Glede na to, da pa so možgani program, pa bo to v prihodnosti vsekakor mogoče.

Vprašanje pa je, kaj je zavest.

1. Produkt spominov, občutij...
2. Neodvisna od spominaov, občutij...

Vidi še kdo, kakšno tretjo možnost?

Možgani so program. Programe se da spreminjat. Človeku odvzamemo vsa čutila. Kaj ostane? Čustva, spomini. Odvzamemo še to. Kaj ostane???

Thomas, povej zakaj si tako prepričan o univerzalni zavesti.

Thomas ::


    Spominov zaenkrat ni imela nobena oseba istih, kot druga.

Problem je samo v tem, da imata dve različni osebi, v nekem trenutku, zlahka bolj podobne spomine, kot ena oseba, v različnih časovnih obdobjih. Dvojček Pavel ima pri petih letih podobnejše spomine spominom bratca Petra, kot pa so ti njegovi (Pavletovi) spomini, podobni spominom Pavleta, ko bo 50 let star.

Je tako?

    Glede na to, da pa so možgani program, pa bo to v prihodnosti vsekakor mogoče.

No jest bi tukaj rekel raje, da so možgani (Turingov) stroj, na katerem tečejo programi. Zavest, spoznavanje vizualnih oblik, memoriranje ...

Ampak mišljeno je pravzaprav isto s tem.

    Vprašanje pa je, kaj je zavest.

Subprogram. En tak rekurziven.


Rekurzijo smo fiziološko razvili le ljudje. Pa nisem prepričan, da je to že zadosti. Večino časa, naši biološko enaki predniki, zavesti, prav mogoče - še niso imeli!

Kako, sto milijonov hudičev, naj bi bilo pa to možno?

Kako pa je možno, da je danes IQ večji, kot je bil 100 let nazaj?

Tudi, če ne verjamemo v adekvatnost IQ-ja - inteligentnejši smo. Tega ni možno razložiti z biološkimi spremembami, ki so v 100 letih zanemarljive. Kako to?

Navedel sem že na tem forumu še dva taka primera. Namreč kako je možno, da so (Homo Sapiens Sapiens) rabili nekaj deset tisoč let, preden so sekire brusili z obeh strani? Kako je možno, da so bili tako tupi, da so imeli tako dolgo tupe sekire.

Potem pa "nenadoma" ... samo še ostre z obeh strani.

Pa še drugi, novejši primer. Kako je možno, da so nemški brodolomci 100 let nazaj ob Avstralski obali umirali od lakote ob obali polnega morja?

Odgovor na vsa ta vprašanja je jasen, če privzamemo, da je človeška žival "le" Turingov stroj, na katerem se renderirajo memi, ki v bistvu odločajo o vsem.

Težko - oziroma počasi - se zrenda mem o koristnosti ostrenja sekire z obeh strani, kjer je memov malo - pa četudi je wetware (že) dober. Rendal je pač druge - bolj socialne in razmnoževalne reči.

V mempleksu tistih Nemcev ni bilo date, da je školjke mogoče razbijati in jesti. Taka slaba biološka razgledanost je bila pač normalna tudi za prebivalce Dalmacije, ki so bili nekaj 10 kilometrov od morja in umirali od lakote, par 100 let nazaj. Njihov memplex jim enostavno ni dopuščal oditi do obale in naloviti nekaj rib! Ni bilo izračunljivo to za njihovo pamet. Loviti krte in voluharje na vrtu in jih peči - pa tudi ne.

Če gledamo skozi oči memov, katerim "meso" dobavlja le computing - potem so nam take reči bolj jasne.

Zavest je le še en mem.

Le še en mem, ki se je zrenderiaral skozi dolga časovna obdobja in se naseli v glavi otroka današnjega dne - pri par letih starosti.

Pride tja predvsem z govorom, kretnjami, pojavitijo hrane ob lakoti ... takimi simboli, s katerimi memi potujejo.

Kar pravzaprav so.

Je torej mogoče, da zavest je koda?

Napislijva v naravnem jeziku ali v C++?

Jest mislim da ja.

Too much?

Take a breath!

    Vidi še kdo, kakšno tretjo možnost?

Ja, vidi še kdo, kakšno tretjo možnost?

Man muss immer generalisieren - Carl Jacobi

.:joco:. ::

Naš IQ je enak kot pred 15 000 leti. Če bi tistega človeka takrat pri treh letih učil dva jezika, mu dal za sestavljati Lego kocke in šestih letih poštevanko, zraven pa bi še igral tetris in solitarie, bi bil ravno tako pameten kot vsak povprečen človek danes. Ljudje v zadnjih 100 letih ne bi naredili toliko, če ne bi bilo prejšnjih 5000 let.
"Is science true?"
You don't get it.
Science is the process of trying to find out what's true.
strani: 1 2 3 4 ... 86

Vredno ogleda ...

TemaSporočilaOglediZadnje sporočilo
TemaSporočilaOglediZadnje sporočilo

subjektivna izkusnja in umetna inteligenca

Oddelek: Znanost in tehnologija
251775 (1232) OwcA

Delujoč model hiperprostorskega pogona (strani: 1 2 )

Oddelek: Novice / Znanost in tehnologija
708259 (5170) antonija

Barvna uganka (strani: 1 2 )

Oddelek: Loža
552844 (2093) Tomi

Thomas, pomagaj mi pri širjenju "krive vere" (strani: 1 2 )

Oddelek: Znanost in tehnologija
674561 (3228) Thomas

dednost + okolje = človek ?

Oddelek: Znanost in tehnologija
281813 (1412) Valentin

Več podobnih tem