» »

Severnokorejski hekerji nad proizvajalce cepiv za Covid-19?

Severnokorejski hekerji nad proizvajalce cepiv za Covid-19?

vir: Pixabay

vir: Reuters
Reuters - Hekerji naj bi si tako pred dnevi poskušali s pomočjo socialnega inženiringa pridobiti dostop do računalnikov nekaterih zaposlenih britanski družbi AstraZeneca, znani po tem, da je tik pred koncem razvoja svojega cepiva proti Covid-19.

Storilci so nastopili pod krinko ponudnikov zaposlitev na družbenih omrežjih Linkedin in WhatsApp, zainteresiranim posameznikom pa so nato poslali dokumente, povezane s podrobnostmi o zaposlitvi. Dokumenti so vsebovali tudi zlobno kodo, zasnovano za omogočanje dostopa do žrtvine naprave. Med tarčami so bili tudi zaposleni, ki delajo neposredno na razvoju cepiva.

Reutersovi anonimni viri incident povezujejo s Severno Korejo na podlagi v napadu uporabljenih orodij in tehnik, te naj bi bile del obširnejše hekerske kampanje, ki jo varnostni strokovnjaki in predstavniki ZDA prepisujejo prav tej državi. Ta kampanja je bila sicer doslej bolj osredotočena na obrambne ustanove in medijske organizacije, v zadnjih tednih pa se je preusmerila na tarče povezane s Covid-19. Z napadi naj bi si Severnokorejci poskušali pridobiti vzvode za izsiljevanje teh podjetij, lahko pa tudi strateško prednost v boju s pandemijo, ugibajo analitiki.

Da do takih napadov zares prihaja, so pred tedni opozorili tudi predstavniki Microsofta in pozvali svetovne vlade naj se opredelijo do določb mednarodnega prava, ki ščiti zdravstvene ustanove, nato pa ukrepajo, da se ti predpisi začno udejanjati.

Predstavniki Severne Koreje in AstraZenece se za zdaj niso odzvali na novinarska vprašanja.

Severno Koreja je bila sicer doslej že večkrat obtožena hekerskih napadov, poročilo OZN je lani navajalo, da so si z njimi pridobili že dve milijardi ameriških dolarjev sredstev. Tamkajšnji režim naj bi tako stal za vdorom v Sony Pictures, krajo denarja iz bangladeške centralne banke, vdorom v SWIFT, virusom WannaCry itd.

41 komentarjev

DexterBoy ::

Nekaj mi ni jasno;
Kako to, da se v ustanovi, ki se ukvarja s cepivom, dovoljuje dostop do socialnih omrežij? Mar nimajo požarne pregrade, ki bi to blokirala? Tako za spletni dostop kot elektronsko pošto? Mar je res tako težko (pa dvomim, da ni denarja) zaposliti par operaterjev, ki bi poleg avtomatike še ročno pregledovali spam pošto? Ali se ne more med zaposlenimi na mail strežniku implementirati digitalno podpisovanje pošte? Dati seznam "dovoljenih mail naslovov", ostalo pa avtomatično roma v koš? Me ne bi čudilo, da bi nekdo napisal, da imajo še službene telefone povezane preko brezžičnega vmesnika na službene računalnike...
Ker če tole zgoraj nimajo porihtano, jim kar privoščim, da udrejo v sistem in vse "skorumptirajo". Potlej pa 1000 BTC za odkupnino...
Aja, pozabil dodati; da nima tale AstraZeneca implementirane še oblačne storitve? Ker če da... je to smeha polna hiša :))

pa še rahlo off topic;
Severna Koreja je država, kjer si nihče ne želi živeti. Pa navkljub vsemu nimajo nobenih težav (lockdown...) zaradi Covida, pa še njihova IT srenja je sposobnejša od Slovenske. Khm... kje je življenje boljše? ;)
Ko ne gre več, ko se ustavi, RESET Vas spet v ritem spravi.

Zgodovina sprememb…

A_A ::

DexterBoy je izjavil:

Nekaj mi ni jasno;
Kako to, da se v ustanovi, ki se ukvarja s cepivom, dovoljuje dostop do socialnih omrežij? Mar nimajo požarne pregrade, ki bi to blokirala? Tako za spletni dostop kot elektronsko pošto? Mar je res tako težko (pa dvomim, da ni denarja) zaposliti par operaterjev, ki bi poleg avtomatike še ročno pregledovali spam pošto? Ali se ne more med zaposlenimi na mail strežniku implementirati digitalno podpisovanje pošte? Dati seznam "dovoljenih mail naslovov", ostalo pa avtomatično roma v koš? Me ne bi čudilo, da bi nekdo napisal, da imajo še službene telefone povezane preko brezžičnega vmesnika na službene računalnike...
Ker če tole zgoraj nimajo porihtano, jim kar privoščim, da udrejo v sistem in vse "skorumptirajo". Potlej pa 1000 BTC za odkupnino...
Aja, pozabil dodati; da nima tale AstraZeneca implementirane še oblačne storitve? Ker če da... je to smeha polna hiša :))

pa še rahlo off topic;
Severna Koreja je država, kjer si nihče ne želi živeti. Pa navkljub vsemu nimajo nobenih težav (lockdown...) zaradi Covida, pa še njihova IT srenja je sposobnejša od Slovenske. Khm... kje je življenje boljše? ;)

po tem kar si napisal imam občutek, da si še prezelen, da bi razumel kako funkcionira kapitalizem.. nažalost :)

Afo ::

@A_A condescending much? Kapitalizem ali konstantno potovanje po poti najmanjšega upora. Ti dve zadevi nista ista stvar. Si upam trdit, da je slednje verjetnejši odgovor.

Na jetra mi gre, da po napadu sporočajo kdo je napadalec. SPLOH pa ko to izjavlja država ki obtožuje svojo klasično sovražnico... dokazi? So uporabljali severnokorejki sleng v pismenkah v kodi (kot da bi to bil dokaz)? Ajaaa, dostopal so iz tistega EDINEGA IPja ki ga ima Severna Koreja...
Bolje biti mlad in neumen, kot samo neumen!

gruntfürmich ::

DexterBoy je izjavil:

Nekaj mi ni jasno;
Kako to, da se v ustanovi, ki se ukvarja s cepivom, dovoljuje dostop do socialnih omrežij? Mar nimajo požarne pregrade, ki bi to blokirala? Tako za spletni dostop kot elektronsko pošto?

si ti že sploh delal v kakšnem podjetju?
"Namreč, da gre ta družba počasi v norost in da je vse, kar mi gledamo,
visoko organizirana bebavost, do podrobnosti izdelana idiotija."
Psiholog HUBERT POŽARNIK, v Oni, o smiselnosti moderne družbe...

Kvinta ::

Čez 30 let bojo pa rekli da je bla za vsem Cia :))

vostok_1 ::

Samo za info. mRNA cepiva so povsem sintetična. To pomeni, da nastanejo primarno na računalniku.
V primeru uspešnega hekerskega napada, bi lahko zlonamerneži nadomestili originalno kodo cepiva z nekaj njihovega.
Vi kasneje pa si to vbrizgali.

Zgolj, če ne bi pred izdajo v proizvodnjo preverili checksum uporabljene kode.

Veselo pikanje 2021 folk.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

Afo ::

vostok_1 je izjavil:

Samo za info. mRNA cepiva so povsem sintetična. To pomeni, da nastanejo primarno na računalniku.
V primeru uspešnega hekerskega napada, bi lahko zlonamerneži nadomestili originalno kodo cepiva z nekaj njihovega.
Vi kasneje pa si to vbrizgali.

Zgolj, če ne bi pred izdajo v proizvodnjo preverili checksum uporabljene kode.

Veselo pikanje 2021 folk.

Sam po tvoji "logiki" so potem primarno bioloska, ker nastanejo najprej v mozganih izobrazene osebe, ki ga proizvaja in za razliko od tebe o tem celo kaj ve.

Poleg tega v zivljenju se nisem slisal za "naravno cepivo". Vsa cepiva naredi "sinteticno" clovek z napravami ki jih je izumil (v to spada tudi racunalnik).
Bolje biti mlad in neumen, kot samo neumen!

vostok_1 ::

Ne vem kako logiko uporabljaš, ampak to ni moja.

Povsem sintetična je bilo mišljeno kot skoncipirana v softwerju. Jasno, z uporabo "bioloških" komponent.
Razlika je precejšnja. Cepivo za črne koze so razvili v času ko še ni bilo elektrike.
Tako cepivo je bistveno težje poljubno hekat. Kvečjemu lahko fizično napadeš proizvodnjo.
Pri mRNA cepivih spremeniš source kodo v nekem fajlu in imaš že nekaj drugega.

Mislim, upam, da se ta podjetja držijo računalniških varnostnih standardov. Ampak...kot rečeno. Vi se boste pač pikali z njimi.

In že če smo pri bioloških zdravihil. Ravno tako ne bi zaupal biološkim zdravilom, ki pridejo iz vplivne cone CCP.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

gruntfürmich ::

vostok_1 je izjavil:

Mislim, upam, da se ta podjetja držijo računalniških varnostnih standardov. Ampak...kot rečeno. Vi se boste pač pikali z njimi.
se ti ne zdi, da iz te novice ne moreš sklepat o varnosti v računalnikih, ki so odgovorni za proizvodnjo cepiva?
"Namreč, da gre ta družba počasi v norost in da je vse, kar mi gledamo,
visoko organizirana bebavost, do podrobnosti izdelana idiotija."
Psiholog HUBERT POŽARNIK, v Oni, o smiselnosti moderne družbe...

vostok_1 ::

No, ironično je res ja.
Očitno imajo luknjičaste sisteme.
Ampak vseeno optimist nekje v meni pravi, da vsaj en prekleti checksum na main file bi lahko izvedli.

So pa severno korejski hekerji dober izgovor za "ups...we've sterilized you, but only because of north korean hackers"
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

gruntfürmich ::

meni se zdi da je glavni cilj industrijska špijonaža in ne oviranje proizvodnje. ker proizvodnja bo v vsakem primeru stekla, če bodo naredili škodo ali ne. ampak najbolj verjetno je da proizvodnje ne morejo ustaviti, načrte pa lahko ukradejo...
"Namreč, da gre ta družba počasi v norost in da je vse, kar mi gledamo,
visoko organizirana bebavost, do podrobnosti izdelana idiotija."
Psiholog HUBERT POŽARNIK, v Oni, o smiselnosti moderne družbe...

Invictus ::

A zdaj bodo pa za zajebe proizvajalcev cepiv krivi Severnokorejci?

A niso dežurni krivci Rusi ?!?!?!
"Life is hard; it's even harder when you're stupid."


gruntfürmich ::

Invictus je izjavil:

A zdaj bodo pa za zajebe proizvajalcev cepiv krivi Severnokorejci?

A niso dežurni krivci Rusi ?!?!?!

dobra ja :))
bum, polno mrtvih, cepivo v napačnih odmerkih, stranske reakcije... kriva severna koreja :D
"Namreč, da gre ta družba počasi v norost in da je vse, kar mi gledamo,
visoko organizirana bebavost, do podrobnosti izdelana idiotija."
Psiholog HUBERT POŽARNIK, v Oni, o smiselnosti moderne družbe...

zmaugy ::

Ma ne, Severna Koreja pa že ne heka, no way. Oni so gud gajs. No, razen polivanja ljudi v javnosti z VX živčnim bojnim strupom (kar je pa itak izmišljotina, kot ruski Novičok, ane?)...

Zgodovina sprememb…

  • spremenilo: zmaugy ()

Senior Dev ::

Za te je rešitev 20 kosov MOAB (mati vseh bomb) in ne bodo več rabili cepiva, niti jedrskih konic, niti tako zvanih "self pwnd" raket ki letijo v random smer.
Še vedno delam u fabrki!

antonija ::

vostok_1 je izjavil:

Samo za info. mRNA cepiva so povsem sintetična. To pomeni, da nastanejo primarno na računalniku.
V primeru uspešnega hekerskega napada, bi lahko zlonamerneži nadomestili originalno kodo cepiva z nekaj njihovega.
Vi kasneje pa si to vbrizgali.

Zgolj, če ne bi pred izdajo v proizvodnjo preverili checksum uporabljene kode.

Veselo pikanje 2021 folk.
Ce te prav razumem si ti preprican, da se mRNA cepiva "printajo" direktno iz racunalnika? 8-O
 I tata bi sine...

I tata bi sine...

Statistically 3 out of 4 involved usually enjoy gang-bang experience.

vostok_1 ::

antonija je izjavil:

vostok_1 je izjavil:

Samo za info. mRNA cepiva so povsem sintetična. To pomeni, da nastanejo primarno na računalniku.
V primeru uspešnega hekerskega napada, bi lahko zlonamerneži nadomestili originalno kodo cepiva z nekaj njihovega.
Vi kasneje pa si to vbrizgali.

Zgolj, če ne bi pred izdajo v proizvodnjo preverili checksum uporabljene kode.

Veselo pikanje 2021 folk.
Ce te prav razumem si ti preprican, da se mRNA cepiva "printajo" direktno iz racunalnika? 8-O
 I tata bi sine...

I tata bi sine...

Kdo pa je rekel to?

BW, preden obtožiš koga teorij zarote, moraš najprej prebrati kaj je sploh ta isti napisal.
Kot rečeno, bakterijska pljučnica bi te malo skalibrirala.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

antonija ::

vostok_1 je izjavil:

Kdo pa je rekel to?
Ti ;)

vostok_1 je izjavil:

Samo za info. mRNA cepiva so povsem sintetična. To pomeni, da nastanejo primarno na računalniku.
V primeru uspešnega hekerskega napada, bi lahko zlonamerneži nadomestili originalno kodo cepiva z nekaj njihovega.
Vi kasneje pa si to vbrizgali.

Zgolj, če ne bi pred izdajo v proizvodnjo preverili checksum uporabljene kode.
Med razvojem in prozvodnjo zdravila mine kar nekaj casa, vmes pa racunalniki niso nic vec vkljuceni v proizvodnjo zdravil, vsaj ne do te mere da bi lahko vplivali na sestavine zdravil/cepiv.

Poleg tega pa ne samo da se _vsako_serijo_ zdravil/cepiv pred sprostitvijo na trg preveri ce vsebuje res to kar mora in nic drugega (identifikacijski testi), pogleda se tudi ce so tudi kolicine/koncentracije sestavin v predpisanih mejah (kvantifikacijski testi), povrh se pa preveri se in-vitro ucinkovitost ucinkovin z bioloskim ucinkom (performance testi). Dodatne se analizira se za morebitne necistote v izdelku.
Vse rezultate na koncu podpise za to zadolzena oseba (qualified person; QP), ki s svojim podpisom kazernsko odgovarja za ustreznost zdravila kar se tice kakovosti, varnosti in ucinkovitosti. Ce gre z doticno serijo kaj narobe (npr. nekdo umre zaradi neustrezne analize zdravila pred sprostitvijo serije na trg), grozi QPju kazen po lokalnih zakonih (pri nas zapor, ponekod tudi smrtna kazen).
Poleg kaznovanja fizicne osebe (vrsilca funkcije QPja) pa seveda najebe se firma ($$) zaradi kazenske odgovornosti.

Na kratko: Nehaj nabijat v prazno o tem kako bo heker z vdorom uspel spremeniti sestavo zdravila/cepiva.
Statistically 3 out of 4 involved usually enjoy gang-bang experience.

darkolord ::

> Kot rečeno, bakterijska pljučnica bi te malo skalibrirala.

Antibiotik. Next?

vostok_1 ::

antonija je izjavil:

vostok_1 je izjavil:

Kdo pa je rekel to?
Ti ;)

vostok_1 je izjavil:

Samo za info. mRNA cepiva so povsem sintetična. To pomeni, da nastanejo primarno na računalniku.
V primeru uspešnega hekerskega napada, bi lahko zlonamerneži nadomestili originalno kodo cepiva z nekaj njihovega.
Vi kasneje pa si to vbrizgali.

Zgolj, če ne bi pred izdajo v proizvodnjo preverili checksum uporabljene kode.
Med razvojem in prozvodnjo zdravila mine kar nekaj casa, vmes pa racunalniki niso nic vec vkljuceni v proizvodnjo zdravil, vsaj ne do te mere da bi lahko vplivali na sestavine zdravil/cepiv.

Poleg tega pa ne samo da se _vsako_serijo_ zdravil/cepiv pred sprostitvijo na trg preveri ce vsebuje res to kar mora in nic drugega (identifikacijski testi), pogleda se tudi ce so tudi kolicine/koncentracije sestavin v predpisanih mejah (kvantifikacijski testi), povrh se pa preveri se in-vitro ucinkovitost ucinkovin z bioloskim ucinkom (performance testi). Dodatne se analizira se za morebitne necistote v izdelku.
Vse rezultate na koncu podpise za to zadolzena oseba (qualified person; QP), ki s svojim podpisom kazernsko odgovarja za ustreznost zdravila kar se tice kakovosti, varnosti in ucinkovitosti. Ce gre z doticno serijo kaj narobe (npr. nekdo umre zaradi neustrezne analize zdravila pred sprostitvijo serije na trg), grozi QPju kazen po lokalnih zakonih (pri nas zapor, ponekod tudi smrtna kazen).
Poleg kaznovanja fizicne osebe (vrsilca funkcije QPja) pa seveda najebe se firma ($$) zaradi kazenske odgovornosti.

Na kratko: Nehaj nabijat v prazno o tem kako bo heker z vdorom uspel spremeniti sestavo zdravila/cepiva.

Točen način hekanja sicer res ne poznam. Je pa pri takem cepivu recimo večja možnost za skrite manipulacije, če se dokoplješ do izvorne kode, kar recimo pri tetanusu.

Prepričan sem, da bi laborant lahko odkril noti nekaj tujega. Ne vem pa če bi odkril določen edit kode.

Glede kazenske odgovornosti itak. Tehnik podpiše, da gre to v promet in je kazensko odgovoren. Zmetat par grešnih kozlov v ogenj je standardna praksa že tisoče let.
Performance test pa zagotovo bi pokazal dober performans, na testu, za katerega ne veš kaj meri.
Če ti john hopkins narejen performance test pošljejo in se izkaže kot dober, gre za zaupanje john hopkinsu.

Sklepam, da delaš v tem fohu, glede na poznavanje.

Sicer pa me manipuliranje cepiv v proizvodnji še najmanj skrbi. To je še najbolj ezoterični del zarote, ki sploh ni ključen.
Če bi se že lotili depopulacije ljudi, to ne bi počeli z podkupovanjem laborantov.
Enostano narediš cevpivo, ki pripravi telo, da burno reagira na nek virus, ki ga spustiš.

Zgolj hipotetično...recimo, da bi ti povzročalo citokinsko nevihto.
Če že, bi to bil bolj vrjeten vektor napada kot podkupovanje ljudi na minimalcu.

Sicer pa kot sem rekel. Zgleda, da večina big farma korporacij ima pripopane neke no-name firmice, ki so odgovorne za cepivo.
Moderna, bioINtech itd.

Moderna ti naredi recepturo in performance test, ti laboratorijski "bedak" pa potrdiš, da današnja šarža dela odlično.
It's that easy.

darkolord je izjavil:

> Kot rečeno, bakterijska pljučnica bi te malo skalibrirala.

Antibiotik. Next?

Torej več kot rabimo mi naredit za covid okužbo.

I'll take coivd tnx.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

Zgodovina sprememb…

  • spremenil: vostok_1 ()

antonija ::

Točen način hekanja sicer res ne poznam.
Kar te pa ne bo ustavilo da nebi natresel se kaksne senzacionalisticne trditve, a?
Prepričan sem, da bi laborant lahko odkril noti nekaj tujega.
Laborant je smao izvajalec analize. Za njim je se vsaj en pregledovalec ki analizo overi in preveri rezultate, za tem pa se en reviewer ki preveri rezultate. Veicno potem sledi se vodja laboratorija (ki potrdi da so to koncni rezultati za njegov laboratorij), na koncu pa sledi ze prej omenejni QP, ki je ponavadi visoko solan kader (povecini PhD).
Performance test pa zagotovo bi pokazal dober performans, na testu, za katerega ne veš kaj meri.
Mogoce ti ne ves kaj meri, firma mora pred drzavamo pokazati da tocne ve kaj meri in da apokaze korelacjo med in-vitro in in-vivo performancnimi testi. Veliko dosjejev za zdravila ne gre skozi ravno zato, ker analitika ni vredu postimana in ker firme ne uspejo pokazati ustrezne in-vivo - in-vitro korelacije.
Če bi se že lotili depopulacije ljudi, to ne bi počeli z podkupovanjem laborantov.
Enostano narediš cevpivo, ki pripravi telo, da burno reagira na nek virus, ki ga spustiš.
Za to imamo pa klinicne studije, pri katerih je potrebno preverit ali se pokazejo kaksni nezelni ucinki. Kot pravi novica so za zelo hitro izvedbo studij (emergecy thingy) za covid-19 cepivo vseeno uporabili 20k+ subjektov (~1/2 EU, ~1/2 juzna amerika), kar je ze kar lep vzorec za odkritje nezelenih ucinkov, sploh ker so vsi prostovoljci pod zdravniskim nadzorom med in se nakaj casa po studiji.
Sicer pa kot sem rekel. Zgleda, da večina big farma korporacij ima pripopane neke no-name firmice, ki so odgovorne za cepivo.
Moderna, bioINtech itd.
Te "no-name firmice" so ozko specializirana podjetja, katerih glavna naloga je razvoj. Ne ukvarjajo se s transferjem v proizvodnjo, s klinicnimi studijami, s QCjem, z regulativo, itd. Vse to "prepustijo" ta velikim (ki na koncu poberejo tudi vecino dobicka). So pa te male firme nosilke know-howa in so hkrati dovolj agilne, da se lahko hitro prilagodijo razmerjam in se obrnejo v drugo smer ce je to treba. Veliki pac raziskujejo kako iztrziti se kaksno milijardico vec iz Vigare in podobnih "zdravil".

Zdej pa prosim nehaj nabijat o stvareh o katerih nimas pojma, pa pejd raje razlagat svetovne zarote o depopulaciji. Tam bos pozel samo salve smeha, tukaj pa zdraven dobis se val pomilovanja.
Statistically 3 out of 4 involved usually enjoy gang-bang experience.

vostok_1 ::

1. Kaj pa pomaga visoko šolan kader, če dela po navodilih nekoga drugega?
Če nek programer da nasi nek čip in reče, da ga vgradi v kapsulo...mu bo nasa pač morala zaupati, ker nima ne časa, ne denarja reverse-engineer-at reč.
Če ti Moderna, da reagent za testirat nekaj, boš pač zaupal v test.

2. In-vivo test je že vredu. Kako pa veš na kaj vse deluje? Če bi hipotetično recimo covid cepivo pozdravilo tako kovid kot za 50% zmanjšalo plodnost semenčic...v kolikem času bi se to odkrilo dokler ne bi bilo prepozno?

3. Kaj ti pomagajo študije cepiva, ki povzroči citokinsko nevihto, če introduciraš specifičen sev virusa, ki še ne obstaja?

4. Ta male firmice so ravno zato fanj vektor napada...če bi kdo želel napasti. Imamo dokumentirano, da vse te mini firmice je tudi Billy sponzoriral.
Tudi, če ne gre za depopulacijsko cepivo, jaz cepivo ustvarjalca Windowsev si ne bom vbrizgal. Od Linusa cepivo pa bi.

5. Zarota o depopulaciji ni izmišljotina. Ne ve se pa kako točno se bo to izvedlo. Eni predvidevajo cepiva, drugi z emancipacijo žensk. That has yet to be seen. Imamo pa do takrat še veliko večjih problemov. Predvsem na področju uvedbe totalitarizma v naših liberalnih družbah.

PS. Billyjeva cepiva so že povzročila paralize in sterilnost dol po afriki.
Ta tvoj fenomenalni QC je očitno nekje zatajil.
Bojim se, da ti boš požel bolj salve izžvižganja kot pa smeha.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

Zgodovina sprememb…

  • spremenil: vostok_1 ()

antonija ::

vostok_1 je izjavil:

1. Kaj pa pomaga visoko šolan kader, če dela po navodilih nekoga drugega?
Dela po zakonih, ker je osebno odgovoren. QPji so eni od najvecjih zajebancev rvano zato, ker vejo da gre za njihovo rit. To je tudi cela poanta QPjev.

vostok_1 je izjavil:

Če ti Moderna, da reagent za testirat nekaj, boš pač zaupal v test.
N ebos "kar zaupal" ker ti zakon tega ne dovoli. Test lahko izvajas sele, ko pokazes da v tvcojem labu na tvoji opremi s tvojimi ljudmi dela zadovoljivo. Pa se potem moras prepricati vse drzave, v katerih imas namen prodajat, da test ustreza svojemu namenu.

vostok_1 je izjavil:

2. In-vivo test je že vredu. Kako pa veš na kaj vse deluje? Če bi hipotetično recimo covid cepivo pozdravilo tako kovid kot za 50% zmanjšalo plodnost semenčic...v kolikem času bi se to odkrilo dokler ne bi bilo prepozno?
Kdaj bi pa bilo prepozno?

vostok_1 je izjavil:

3. Kaj ti pomagajo študije cepiva, ki povzroči citokinsko nevihto, če introduciraš specifičen sev virusa, ki še ne obstaja?
Kaksen sev virusa ki ne obstaja? O cem spet bluzis?

vostok_1 je izjavil:

4. Ta male firmice so ravno zato fanj vektor napada...če bi kdo želel napasti. Imamo dokumentirano, da vse te mini firmice je tudi Billy sponzoriral.
Dej si preberi prejsnje poste in poskusi pogruntati zakaj je "hekerski napad" na kateroki firmo v verigi irelevanten. V nobenem rpimeru z njimk ne mores zamenjati sestavine cepiva.

vostok_1 je izjavil:

Tudi, če ne gre za depopulacijsko cepivo, jaz cepivo ustvarjalca Windowsev si ne bom vbrizgal. Od Linusa cepivo pa bi.
Fanboyism FTW!

vostok_1 je izjavil:

5. Zarota o depopulaciji ni izmišljotina.
Seveda ni izmisljotina! Samo dokazi manjkajo, ali pa vsaj kaksen tehten argument ki prezivi jutranjo pot domov iz ostarije, to je vse! Defintivno ni izmislijotina, marsikdo bi ji rekel kar dejstvo, k'nede?!

vostok_1 je izjavil:

Ne ve se pa kako točno se bo to izvedlo.

vostok_1 je izjavil:

PS. Billyjeva cepiva so že povzročila paralize in sterilnost dol po afriki.
Credible source or it didn't happen.

vostok_1 je izjavil:

Ta tvoj fenomenalni QC je očitno nekje zatajil.
QC so ljudje in vsi se lahko zmotimo. Na sreco je QC samo en clen v dooolgi verigi varovalk.

vostok_1 je izjavil:

Bojim se, da ti boš požel bolj salve izžvižganja kot pa smeha.
Glede na tvoj naziv so tebe ze krepko ozvizgali, se ti smejali, in te pomilovali. Na zalost pa ne zmores doumeti kako pateticne izjave pises.
Anti-intelektualizem je vedno predstavljal nevarnost clovestvu, in v casu ko ima vsako tele moznost pisanja da je zemlja ravna, da luna ne obstaja, da zemljo vodijo kuscarji, da bo 5G direktno kontroliral misli, da je namen cepiv depopulacija... taki so najhujsa nevarnost za clovestvo, verjetno se hujsa od religij. Ce se mi taki smejijo ali zvizgajo, pa naj! Itak jih poslusa samo zvesta cetica omejencev, potem se pa zadeva hitro konca. Vse je za nekaj dobro.
Statistically 3 out of 4 involved usually enjoy gang-bang experience.

Messiah ::

antonija je izjavil:

vostok_1 je izjavil:

1. Kaj pa pomaga visoko šolan kader, če dela po navodilih nekoga drugega?
Dela po zakonih, ker je osebno odgovoren.

Kaj pomeni osebno odgovoren, predvsem pa kako odgovorjajo?

Zgodovina sprememb…

  • spremenilo: Messiah ()

vostok_1 ::

antonija je izjavil:

vostok_1 je izjavil:

1. Kaj pa pomaga visoko šolan kader, če dela po navodilih nekoga drugega?
Dela po zakonih, ker je osebno odgovoren. QPji so eni od najvecjih zajebancev rvano zato, ker vejo da gre za njihovo rit. To je tudi cela poanta QPjev.

vostok_1 je izjavil:

Če ti Moderna, da reagent za testirat nekaj, boš pač zaupal v test.
N ebos "kar zaupal" ker ti zakon tega ne dovoli. Test lahko izvajas sele, ko pokazes da v tvcojem labu na tvoji opremi s tvojimi ljudmi dela zadovoljivo. Pa se potem moras prepricati vse drzave, v katerih imas namen prodajat, da test ustreza svojemu namenu.

vostok_1 je izjavil:

2. In-vivo test je že vredu. Kako pa veš na kaj vse deluje? Če bi hipotetično recimo covid cepivo pozdravilo tako kovid kot za 50% zmanjšalo plodnost semenčic...v kolikem času bi se to odkrilo dokler ne bi bilo prepozno?
Kdaj bi pa bilo prepozno?

vostok_1 je izjavil:

3. Kaj ti pomagajo študije cepiva, ki povzroči citokinsko nevihto, če introduciraš specifičen sev virusa, ki še ne obstaja?
Kaksen sev virusa ki ne obstaja? O cem spet bluzis?

vostok_1 je izjavil:

4. Ta male firmice so ravno zato fanj vektor napada...če bi kdo želel napasti. Imamo dokumentirano, da vse te mini firmice je tudi Billy sponzoriral.
Dej si preberi prejsnje poste in poskusi pogruntati zakaj je "hekerski napad" na kateroki firmo v verigi irelevanten. V nobenem rpimeru z njimk ne mores zamenjati sestavine cepiva.

vostok_1 je izjavil:

Tudi, če ne gre za depopulacijsko cepivo, jaz cepivo ustvarjalca Windowsev si ne bom vbrizgal. Od Linusa cepivo pa bi.
Fanboyism FTW!

vostok_1 je izjavil:

5. Zarota o depopulaciji ni izmišljotina.
Seveda ni izmisljotina! Samo dokazi manjkajo, ali pa vsaj kaksen tehten argument ki prezivi jutranjo pot domov iz ostarije, to je vse! Defintivno ni izmislijotina, marsikdo bi ji rekel kar dejstvo, k'nede?!

vostok_1 je izjavil:

Ne ve se pa kako točno se bo to izvedlo.

vostok_1 je izjavil:

PS. Billyjeva cepiva so že povzročila paralize in sterilnost dol po afriki.
Credible source or it didn't happen.

vostok_1 je izjavil:

Ta tvoj fenomenalni QC je očitno nekje zatajil.
QC so ljudje in vsi se lahko zmotimo. Na sreco je QC samo en clen v dooolgi verigi varovalk.

vostok_1 je izjavil:

Bojim se, da ti boš požel bolj salve izžvižganja kot pa smeha.
Glede na tvoj naziv so tebe ze krepko ozvizgali, se ti smejali, in te pomilovali. Na zalost pa ne zmores doumeti kako pateticne izjave pises.
Anti-intelektualizem je vedno predstavljal nevarnost clovestvu, in v casu ko ima vsako tele moznost pisanja da je zemlja ravna, da luna ne obstaja, da zemljo vodijo kuscarji, da bo 5G direktno kontroliral misli, da je namen cepiv depopulacija... taki so najhujsa nevarnost za clovestvo, verjetno se hujsa od religij. Ce se mi taki smejijo ali zvizgajo, pa naj! Itak jih poslusa samo zvesta cetica omejencev, potem se pa zadeva hitro konca. Vse je za nekaj dobro.

1. Kateri zakon preprečuje zlobnemu akterju, da ti ne proda nekaj slabega?
QP bo že naredil vse natančno po spisku. Četudi spisek zahteva živ obredni zakol koze satanu. Bo ga pač naredil zelo dosledno in po pravilniku, ki so mu ga dali.
Koliko so plačani OPji, tko v povprečju?

2. Tvoj lab in tvoja oprema bo umerjena po vseh ISO standardih.

3. Kdaj prepozno? Well...let's say enkrat ko kupiš 300 miljonov odmerkov in jih v par mesecih distribuiraš celemu prebivalstvu.

4. Ti kot QP ne boš uspel zavržti cepivo, ki v kombinaciji z covid-2x povzroči citokinsko nevihto in pomori 3/4 prebivalstva.
Predvsem zato, ker covid-2x še ne obstaja v obdobju, ko si ti potrjeval standarde.

5. Windowsovo cepivo bo ravno tako luknjičasto kot sam OS. No thanks. Glede varnosti Linux zmaga. Winsi so zgolj za igračkanje.

6. Ni izmišljotina ker so nam namignili, vse od Club of Rome.
Vem pa, da ti tega nočeš slišati, zato ne vem kako naj te prepričam. A bi ti novo izdana knjiga zarotnikov kaj spremenila mnenje?

7. To, da se je nek QC zmotil ne povrne zdravja tistim, ki so zaradi tega najebali.

8. Kaj ima 5G veze s tem, da po številnih ulicah v evropi policaji oblečeni v full body gear tepejo babice, ki nimajo maske...ne vem. Mi boš moral obrazložiti.
Če se tebi to zdi ok, pol nismo mi omejenici, ampa ti. Uživaj v covid totalitarizmu. Kaj naj rečem.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

DexterBoy ::

gruntfürmich je izjavil:

DexterBoy je izjavil:

Nekaj mi ni jasno; Kako to, da se v ustanovi, ki se ukvarja s cepivom, dovoljuje dostop do socialnih omrežij? Mar nimajo požarne pregrade, ki bi to blokirala? Tako za spletni dostop kot elektronsko pošto?
Si ti že sploh delal v kakšnem podjetju?

Joup, delam. Bančništvo ;)
In zato nisem kar tako naložil nekaj v tri dni. In tudi nisem 20-letnik...
Ko ne gre več, ko se ustavi, RESET Vas spet v ritem spravi.

Zgodovina sprememb…

darkolord ::

1. Pravijo, da je poskus napada bil neuspešen, tako da očitno ne gre AZ kriviti za slabo varnost
2. Precej verjetno je, da so zaposlene kontaktirali preko domačih račun(alnik)ov.

borisk ::

joj, vostok ne spuščaj se v zadeve v katere se spoznaš. antonija ti je lepo napisal postopek, ki je vsakemu precej jasen, razen vam ki v vsaki stvari vidite zaroto. QP ima vsaj v zahodnem svetu precej v šestmesto cifro na leto...

antonija ::

Messiah je izjavil:

antonija je izjavil:

vostok_1 je izjavil:

1. Kaj pa pomaga visoko šolan kader, če dela po navodilih nekoga drugega?
Dela po zakonih, ker je osebno odgovoren.

Kaj pomeni osebno odgovoren, predvsem pa kako odgovorjajo?
Pomeni tocno to kar pise: Ce je Janez Novak QP v podjetju ki proizvaja zdravila in sprosti na trg serijo, za katero se kasneje iskaze da je nebi smel, potem bo Janez Novak kazensko odgovarjal za posledice svojega dejanja.
Npr. ce zaradi doticne serije nekdo umre, je lahko Janez Novak obtozen umora. Fizicna oseba nosi zakonsko odgovornost za svoja dejanja v vlogi QPja, delegiranje kazenske odgovornosti na pravno osebo ne pride v postev.
Statistically 3 out of 4 involved usually enjoy gang-bang experience.

antonija ::

vostok_1 je izjavil:

1. Kateri zakon preprečuje zlobnemu akterju, da ti ne proda nekaj slabega?
QP bo že naredil vse natančno po spisku. Četudi spisek zahteva živ obredni zakol koze satanu. Bo ga pač naredil zelo dosledno in po pravilniku, ki so mu ga dali.
Koliko so plačani OPji, tko v povprečju?
Stevilke niso javno znane, so pa to zneski primerni za VIII stopnjo izobrazbe. Vseeno prenizki da bi bil kaksen strasen naval na delovna mesta za QPje, ker vecina smatra da je odgovornost prevelika. Zelo tezko je dobiti kandidate.

vostok_1 je izjavil:

2. Tvoj lab in tvoja oprema bo umerjena po vseh ISO standardih.
ISO strandarde se v farmaciji uporablja samo tam, kjer strozji standardi ne obstajajo. ISO standardi so preohlapni.

vostok_1 je izjavil:

3. Kdaj prepozno? Well...let's say enkrat ko kupiš 300 miljonov odmerkov in jih v par mesecih distribuiraš celemu prebivalstvu.
In potem ugotovis da pri 1-na-milijon pride do nezelenega ucinka, npr. Evropa ima trenutno nekaj cez 1 milijon mrtvih za COVIDom. Ce jih cepivo resi 90%, ali je vredno administrirat cepivo ki pri 300 osebkih povzroci padec plodnosti za 50%? Pri 3000? Pri 30.000? Pri 300.000?

vostok_1 je izjavil:

4. Ti kot QP ne boš uspel zavržti cepivo, ki v kombinaciji z covid-2x povzroči citokinsko nevihto in pomori 3/4 prebivalstva.
Predvsem zato, ker covid-2x še ne obstaja v obdobju, ko si ti potrjeval standarde.
Hipercitokinemija se lahko pojavi ob veliko razlicnih okuzbah, sklepam da si se besede priucil ker trenutno kaze da lahko tudi SARS-COV-2 sprozi hipercitokinemijo (poleg virusov gripe, virusov herpesa, nekaterih streptokokov, itd.). In ce cepivo pri 3/4 populacije povzroci hude nezelene ucinke, se to zelo hitro opazi med klinicnimi studijami.

vostok_1 je izjavil:

5. Windowsovo cepivo bo ravno tako luknjičasto kot sam OS. No thanks. Glede varnosti Linux zmaga. Winsi so zgolj za igračkanje.
Oh dear... ti si predstavljas da ker je Gates Fundation sponzoriral raziskave da so posledicno Microsoftovi programerji vkljuceni v razvoj cepiv??

vostok_1 je izjavil:

6. Ni izmišljotina ker so nam namignili, vse od Club of Rome.
Vem pa, da ti tega nočeš slišati, zato ne vem kako naj te prepričam. A bi ti novo izdana knjiga zarotnikov kaj spremenila mnenje?
Aja, ce so "vam" pa "namignili", potem bo pa ze drzalo. Se opravicujem zaradi zahteve po dokazih ali vsaj argumentih, how silly of me.

vostok_1 je izjavil:

7. To, da se je nek QC zmotil ne povrne zdravja tistim, ki so zaradi tega najebali.
Kot receno je QC samo ena od varovalk v verigi tako da zajeb QC ne privzema skode na pacientih.

vostok_1 je izjavil:

Kaj naj rečem.
Kaj veliko ti res ne preostane, ker si nazorno pokazal da nimas pojma o cem govoris. Lahko poskusis z izobrazevanjem, ampak sem preprican da ze vse ves, tudi ce vsa dejstva nakazujejo ravno nasprotno.
Statistically 3 out of 4 involved usually enjoy gang-bang experience.

fikus_ ::

Antonija, kako se ti da (vostoke=dežuren trol na ST in zagovornik zarot).

Sicer pa dobri odgovori.

vostok_1 ::

antonija je izjavil:

vostok_1 je izjavil:

1. Kateri zakon preprečuje zlobnemu akterju, da ti ne proda nekaj slabega?
QP bo že naredil vse natančno po spisku. Četudi spisek zahteva živ obredni zakol koze satanu. Bo ga pač naredil zelo dosledno in po pravilniku, ki so mu ga dali.
Koliko so plačani OPji, tko v povprečju?
Stevilke niso javno znane, so pa to zneski primerni za VIII stopnjo izobrazbe. Vseeno prenizki da bi bil kaksen strasen naval na delovna mesta za QPje, ker vecina smatra da je odgovornost prevelika. Zelo tezko je dobiti kandidate.

vostok_1 je izjavil:

2. Tvoj lab in tvoja oprema bo umerjena po vseh ISO standardih.
ISO strandarde se v farmaciji uporablja samo tam, kjer strozji standardi ne obstajajo. ISO standardi so preohlapni.

vostok_1 je izjavil:

3. Kdaj prepozno? Well...let's say enkrat ko kupiš 300 miljonov odmerkov in jih v par mesecih distribuiraš celemu prebivalstvu.
In potem ugotovis da pri 1-na-milijon pride do nezelenega ucinka, npr. Evropa ima trenutno nekaj cez 1 milijon mrtvih za COVIDom. Ce jih cepivo resi 90%, ali je vredno administrirat cepivo ki pri 300 osebkih povzroci padec plodnosti za 50%? Pri 3000? Pri 30.000? Pri 300.000?

vostok_1 je izjavil:

4. Ti kot QP ne boš uspel zavržti cepivo, ki v kombinaciji z covid-2x povzroči citokinsko nevihto in pomori 3/4 prebivalstva.
Predvsem zato, ker covid-2x še ne obstaja v obdobju, ko si ti potrjeval standarde.
Hipercitokinemija se lahko pojavi ob veliko razlicnih okuzbah, sklepam da si se besede priucil ker trenutno kaze da lahko tudi SARS-COV-2 sprozi hipercitokinemijo (poleg virusov gripe, virusov herpesa, nekaterih streptokokov, itd.). In ce cepivo pri 3/4 populacije povzroci hude nezelene ucinke, se to zelo hitro opazi med klinicnimi studijami.

vostok_1 je izjavil:

5. Windowsovo cepivo bo ravno tako luknjičasto kot sam OS. No thanks. Glede varnosti Linux zmaga. Winsi so zgolj za igračkanje.
Oh dear... ti si predstavljas da ker je Gates Fundation sponzoriral raziskave da so posledicno Microsoftovi programerji vkljuceni v razvoj cepiv??

vostok_1 je izjavil:

6. Ni izmišljotina ker so nam namignili, vse od Club of Rome.
Vem pa, da ti tega nočeš slišati, zato ne vem kako naj te prepričam. A bi ti novo izdana knjiga zarotnikov kaj spremenila mnenje?
Aja, ce so "vam" pa "namignili", potem bo pa ze drzalo. Se opravicujem zaradi zahteve po dokazih ali vsaj argumentih, how silly of me.

vostok_1 je izjavil:

7. To, da se je nek QC zmotil ne povrne zdravja tistim, ki so zaradi tega najebali.
Kot receno je QC samo ena od varovalk v verigi tako da zajeb QC ne privzema skode na pacientih.

vostok_1 je izjavil:

Kaj naj rečem.
Kaj veliko ti res ne preostane, ker si nazorno pokazal da nimas pojma o cem govoris. Lahko poskusis z izobrazevanjem, ampak sem preprican da ze vse ves, tudi ce vsa dejstva nakazujejo ravno nasprotno.

Poglej kako trivialno enostavno ti bom debunkal tvoje navidezno pametne odgovore, niti 5 minut razmišljanja nisem potreboval:

1. 8 stopnja? Torej za slovenske razmere govrimo tam okoli 3k neto na mesec. 3k za tako odgovornost je joke. To je ekvivalent plače čistilke sorazmerno.

2. Ne vrjamem, da si tak avtist, da nisi razumel ISO standard kot prispodobo za pač neke striktne standarde. Lahok je ISO ali kakršen koli k***** ki ga imate.
Povsem zgrešil si bistvo mojega odgovora.
Tudi za kuhanje crystal metha vrjamem, da obstajajo neki standardi.
Totalno mimo ti je zbežlo bistvo.

3. Totalno mimo si zgrešil ravno tako pri cepivih.
Govora je bilo, kdaj je prepozno. Če ti razviješ toksično cepivo, ki ga uspeš nekako vštulit v proizvodnjo brez, da bi QC, QP ali kakršenkoli drugi analitični klinac zaznal...prepozno je, ko distribuiraš to zadevo v kratkem času.
Spet banalen hipotetični primer. Če cepivo ima efekt sterilizacije, ampak to recimo ravi 1 mesec, da telo izvede svoje, potem v 1 mesecu si že efektivno naredil nepopravljivo škode.

Številke, efekt itd. so pač tu zgolj primer.
Če bi bilo cepivo 10 let v testu potem to bi se zagotovo že odkrilo. Ko pa se greš moonshot kot UK, you can seriusly fuck things up.

Upam, da je sedaj point bolj jasen.

Koliko ljudi je pobil covid ti ne veš. Tiste številke so zelo vrjetno napačne glede, na informacije ki curljajo vn. Razen če misliš, da ker znaš skuhat aspirin si ekspert za sars-cov-2 in imaš pregled nad vsemi informacijami.
I doubt it.

4. Trdit, da sem namigoval, da windows programerji razvijajo cepivo, je either uspešen poskus srkazma ali totalnega avtizma in torej nezmožnosti razumevanja prispodob. Že dvakrat isto napako si naredil. Morda ni naključje.
Billy je textbook example cut-throat poslovneša v IT branži, ki ima veliko umazanije za nohtmi.
Če trdiš, da se je na stara leta pokesal, potem se ti nič ne sanja o njem. Najbrž nisi pogledal enega njegovega intervjuja. Jaz pa imam za sabo vsaj 30+ ur preučevanja njegovih nastopov, analiz itd.
Če pa misliš, da ti receptura kuhanja aspirina pri tem kaj pomaga...be my guest. Lepa pravljica za lahko noč.

5. Vprašal sem te ali želiš prebrati njihovo knjigo ali ne. Očitno te ne zanima in bluziš svojo ignoranco še naprej.

6. Jebe se meni in argumentu, koliko Q(r)C-jev je v verigi. Še vedno je prišlo do fuckupa.
Spet mi prepevaš uspavanke.

7. O čemu točno si ti pokazal, da imaš pojma ne vem. Znaš povedati, da imamo dolgo verigo quality controla.
Ki očitno ni deloval oz. je zatajil.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

vostok_1 ::

Iz CoolBitovega linka, morda te bo zanimalo:

The WHO's forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is - ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence - ATATTGCAGCAGTACGCACACA - reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

Veš koliko labov je dosledno izvajalo bullšit PCR test?
Veliko. Po vseh ISO in kurac palac standardih.

Kaj ti pomaga 1000 konjski supercar, če vrtiš kolesa v blatu.

Ti kaj bolj jasno?
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

Zgodovina sprememb…

  • spremenil: vostok_1 ()

darkolord ::

To je res zanimivo, ja.

Za videt neumnost ljudi. Sevda morata matchati oba para primerjev, da pride do ojačenja.

vostok_1 ::

If you say so.

Sicer pa si ravno tako falil point mojega sporočila.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

antonija ::

vostok_1 je izjavil:

Jebe se meni in argumentu.
Pa si pokazal celoten spekter tvoj sposobnosti za debate. :(

sorry fikus_, prav si imel.
Statistically 3 out of 4 involved usually enjoy gang-bang experience.

vostok_1 ::

Ne krivi mene za svoje faile.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

PrimoZ_ ::

Ne se trudi, vostok_1 vse ve.

So mu "powers that be" namignile kao in kaj ;)
Sicer se na skrivaj trudijo zradirat 90% populacije ampak da ne bi bilo preveč enostavno, so "njim" "namignili" da naj bi to počeli :)

vostok_1 ::

Namignili so vsem. Še spletno stran in knjigo imajo.

Ne vem od kje ti ta butasta ideja, da neki skrivajo in samo izbranci smo odkrili njihove zlobne načrte.

Je pa napaka na meni, da od butastih ljudi pričakujem ne-butasta mnenja.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

PrimoZ_ ::

Če nekaj namensko iščeš boš tudi našel.
Sigurno je tudi v bibliji kak zapis na to temo.

vostok_1 ::

Kdo išče?

Javno nam predstavljajo.
Z januarjem bo to še bolj formalno.

Če ne vidite očitnega je to vaš problem. Zgolj ne obtoževat Churchila, da je paranoik, če ste vi bedaki.
There will be chutes!
It came from the lab.
Like tears in rain. Time to die. v_1 2012-21

Vredno ogleda ...

TemaSporočilaOglediZadnje sporočilo
TemaSporočilaOglediZadnje sporočilo

Severnokorejski hekerji nad proizvajalce cepiv za Covid-19?

Oddelek: Novice / Varnost
413353 (866) vostok_1

Hekerski napadi na bolnišnice in raziskovalne ustanove za covid-19 se nadaljujejo

Oddelek: Novice / Varnost
202555 (455) zmaugy

Kitajski vojaški hekerji napadajo ZDA?

Oddelek: Novice / Varnost
296522 (5100) Azrael

Več podobnih tem